MessageCenter  MainPage  Links   Sigma Xi   Key Words  Citations  SlideShow  Grant

RESEARCH

Gonadal Peptides

Activin/Inhibin

What is Inhibin ??

http://www.inhibin.com/

*** Click here to view ABCs of Inhibins and Activins***
(  ~4.9 MB pdf document)

Gonadal Peptides: Activin/Inhibin (Act/Inh) {a}

Activin (Beta-Beta)  

Activin A (Beta A-Beta A); Activn B (Beta B-Beta B); Activin AB (Beta A-Beta B)

Inhibin (Alpha-Beta)

Inhibin A (Alpha- Beta A);  Inhibin B (Alpha-Beta B)

Beta Subunit

Fundulus heteroclitus Act/Inh Beta B subunit, partial cds. GenBank Accession AF503775

Activin/ Inhibin Beta B Protein Alignment (mammal, bird, amphibian):  ClustalW Results 2

Fundulus heteroclitus Act/Inh Beta A subunit, partial cds. (BankIt 738646) GenBank Accession DQ149108

Fundulus heteroclitus Act/Inh Beta A isoform subunit, complete cds.  GenBank Accession DQ387061

 Activin/Inhibin Beta A Protein Alignment (mammal, bird, amphibian, fish) : ClustalW Results 1

Clustal Alignment of Human Inhibin beta A and beta B protein

Fundulus heteroclitus :  Act/Inh Beta A,B,C,D,E [Alignment]

Alpha Subunit

Fundulus heteroclitus Inhibin Alpha subunit, partial cds. GenBank Accession AY836522 {a}

Conserved Domain Database (CDD, Cn3D) (To display structure, download Cn3D

Fundulus heteroclitus Inhibin Alpha subunit, 3'end

Fundulus heteroclitus Inhibin Alpha subunit, 5'end

Fundulus heteroclitus Inhibin Alpha subunit, mRNA, complete cds. (Blastx)(BankIt 723697 , Q140181) GenBank Accession AY836522 {a} [VERSION: AY836522.2  GI:72256201]
 

Inhibin Alpha subunit protein Alignment (w/ Fundulus)

Inhibin Alpha subunit protein Alignment (w/ Mammals,  Chicken, Fish [Fundulus])

BLASTP: Query=  gi|72256202|gb|AAW02847.2| inhibin alpha subunit [Fundulus heteroclitus]
          (346 letters) {a}
 

BLINK: Query: gi|72256202 inhibin alpha subunit [Fundulus heteroclitus] [GI List] {a}

Blast2 (Result) {a}:

Putative conserved domains: TGFB

RPS-BLAST 2.2.11 [Jun-05-2005] {a}
Query= local sequence: gi|72256202|gb|AAW02847.2| inhibin alpha
subunit [Fundulus heteroclitus]
         (346 letters)
 

TGFB (View 3D Structure: Cn3D)

Transforming growth factor-beta (TGF-beta) family; Family members are active as disulphide-linked homo- or heterodimers. TGFB is a multifunctional peptide that controls proliferation, differentiation, and other functions in many cell types.

Fundulus heteroclitus :  Act/Inh BetaB vs. Inh Alpha [Alignment]

Fundulus heteroclitus :  Act/Inh Beta A,B,C,D,E [Alignment]

 Inhibin Regulation of  Steroidogenesis and Oocyte Maturation in Rana pipiens

In vitro estrogen modulation of pituitary and progesterone-induced oocyte maturation in Rana pipiens

Role of Inhibins as an Intragonadal Modulator

Activin/Inhibin in Fundulus heteroclitus Ovary:

Cloning of the Subunits and Effects on Oocyte Maturation (Poster)

(Click on the topics below to start Slide Show)

Society for the Study of Reproduction Presentation

Click here to go to  Activin/Inhibin Beta subunit

Click here to go to  Inhibin Alpha subunit

Click here to go to  Transforming Growth Factor Beta  (TGFB)     Superfamily

Inhibin (Alpha-Beta)

Inhibin A (Alpha- Beta A);  Inhibin B (Alpha-Beta B)

Activin (Beta-Beta)

Activin A (Beta A-Beta A); Activn B (Beta B-Beta B); Activin AB (Beta A-Beta B)

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=OMIM

OMIM  Definition of Inhibin,  Activin and Follistatin

Bremner (1989) stated that inhibin, a gonadal glycoprotein hormone which regulates pituitary FSH (136530) secretion, was postulated to exist in the 1920s and named in 1932, but 'during the next 40 years...attained only slightly more scientific credibility than the unicorn.' Inhibin exists in 2 forms, each of which shares the same alpha subunit and, when covalently linked to 1 of 2 distinct subunits called beta-a and beta-b, strongly inhibits pituitary FSH secretion. On the other hand, the dimers of 2 beta subunits, termed activin, are potent stimulators of FSH secretion and release in vitro. Both Inhibin and Activin are members of the Transforming Growth Factor Beta (TGFB) superfamily.

Ueno et al. (1987) isolated from porcine ovarian follicular fluid a peptide with follicle-stimulating hormone (136530) release inhibitory activity. The molecule, which they designated follistatin, was found to be highly enriched in cysteines and to be composed of a single polypeptide chain. It had no sequence homology with the previously characterized follicular fluid inhibins (147290, 147380, 147390), which are heterodimeric proteins.  Follistatin, an activin (see 147290)-binding protein and activin antagonist in vitro, can bind to heparan sulfate proteoglycans (e.g., 142460) and may function in vivo to present activins to their receptors.

AUTHORS Tanimoto,K., Handa,S., Ueno,N., Murakami,K. and Fukamizu,A. TITLE Structure and sequence analysis of the human activin beta A subunit gene JOURNAL DNA Seq. 2 (2), 103-110 (1991) MEDLINE 92135888 PUBMED 1777673

COMMENT REVIEWED

REFSEQ: This record has been curated by NCBI staff.

The reference sequence was derived from J03634.1.

Summary: The inhibin beta A subunit joins the alpha subunit to form a pituitary FSH secretion inhibitor. Inhibin has been shown to regulate gonadal stromal cell proliferation negatively and to have tumour-suppressor activity. In addition, serum levels of inhibin have been shown to reflect the size of granulosa-cell tumors and can therefore be used as a marker for primary as well as recurrent disease. Because expression in gonadal and various extragonadal tissues may vary severalfold in a tissue-specific fashion, it is proposed that inhibin may be both a growth/differentiation factor and a hormone. Furthermore, the beta A subunit forms a homodimer, activin A, and also joins with a beta B subunit to form a heterodimer, activin AB, both of which stimulate FSH secretion. Finally, it has been shown that the beta A subunit mRNA is identical to the erythroid differentiation factor subunit mRNA and that only one gene for this mRNA exists in the human genome.

Back to Top

Activin/Inhibin Sequence Homology Search 

(using NCBI BlastP search & blink)

Activin/Inhibin (Beta subunit)

Inhibin exists in 2 forms, each of which shares the same alpha subunit and, when covalently linked to 1 of 2 distinct subunits called beta-a and beta-b, strongly inhibits pituitary FSH secretion. On the other hand, the dimers of 2 beta subunits, termed activin, are potent stimulators of FSH secretion and release in vitro. 

Blink using Activin/Inhibin Beta subunit Protein sequence as Query 

BlastP search blink1,  Query: gi|4504699 inhibin beta A subunit precursor; Inhibin, beta-1; EDF [Homo sapiens]

     http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/blink?pid=4504699 

     Entrez Proteins: Blast  Human Beta A  GI List 1

Blast Taxonomy Report 1: (mammal, bird, amphibian)  Activin/Inhibin Beta A

Homo sapiens (human) -------- 2250 36 hits [mammals] inhibin beta A subunit precursor [Homo sapiens] 

Papio hamadryas (baboon) .. 270 1 hit [mammals] myostatin; growth/differentiation f-8; GDF-8 [Papio ham 

Bos taurus (cow) ------ 2177 6 hits [mammals] betaA inhibin/activin precursor [Bos taurus] 

Ovis aries (sheep) ........ 2167 3 hits [mammals] inhibin beta-A-subunit [Ovis aries] 

Mus musculus (house mouse) ... 2164 24 hits [mammals] inhibin beta-A-subunit [Mus musculus] 

Rattus norvegicus (Norway rat) ..... 2161 14 hits [mammals] INHIBIN BETA A CHAIN PRECURSOR 

Equus caballus (horse) .............. 2134 4 hits [mammals] inhibin beta A subunit [Equus caballus] 

Sus scrofa (pig) ........ 2094 5 hits [mammals] inhibin beta-(a) subunit precursor (aa 1-424) [Sus scrofa] 

Oryctolagus cuniculus (European rabbit) ...... 906 3 hits [mammals] activin-A [rabbits, WHHL, Watanabe heritable hyperlipidemia, 

Sus scrofa domestica (domestic pig) .......... 808 1 hit [mammals] inhibin betaB precursor 

Dama sp. ........... 293 1 hit [mammals] Bone morphogenetic protein 2 [Dama sp.] 

Mus sp. (mice) .........263 1 hit [mammals] transforming growth factor-beta homolog=Vgr-2 [mice, embryo, 

Texas fallow deer .. 258 1 hit [mammals] bone morphogenetic protein 4B, BMP-4B [Texas Fallow deers, a 

Canis familiaris (dog) ......... 247 1 hit [mammals] bone morphogenetic protein 4 [Canis familiaris] 

 Cavia porcellus (guinea pig) .... 245 1 hit [mammals] transforming growth factor-beta [Cavia porcellus]  

Gallus gallus (chicken) -------- 1948 17 hits [birds] inhibin/activin beta A-subunit [Gallus gallus] 

Meleagris gallopavo (turkey) ....... 271 2 hits [birds] GROWTH/DIFFERENTIATION FACTOR 8 PRECURSOR (GDF-8) (MYOSTATIN 

Cynops pyrrhogaster (Japanese common newt) ---1597 2 hits [amphibians] activin beta-A subunit [Cynops pyrrhogaster]

 Xenopus laevis (African clawed frog) ....833 20 hits [amphibians] activin beta B subunit [Xenopus laevis, Peptide, 370 aa] 

Eleutherodactylus cystignathoides ...... 253 1 hit [amphibians] Vg1 [Eleutherodactylus cystignathoides]

 Activin/Inhibin Beta A Protein Alignment (mammal, bird, amphibian, fish) : ClustalW Results 1

Back to Top

BlastP search blink1-2, Query: gi|106726 inhibin beta-B chain precursor - human

     http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/blink?pid=106726&quq=5821398

    Entrez Proteins: Blast  Human Beta B  GI List 2

Blast Taxonomy Report 2: (mammal, bird, amphibian)  Activin/Inhibin Beta B

Catarrhini [mammals] 

Homo sapiens (human) -- 2197 35 hits [mammals] inhibin beta B subunit precursor; Inhibin, beta-2; activin A 

Papio hamadryas (baboon)  316 1 hit [mammals] myostatin; growth/differentiation f-8; GDF-8 [Papio ham 

Rattus norvegicus (Norway rat) --- 2150 13 hits [mammals] inhibin beta-B chain precursor - rat 

Bos taurus (cow) ...... 2089 5 hits [mammals] betaB inhibin/activin precursor [Bos taurus] 

Ovis aries (sheep) ...................... 2085 4 hits [mammals] inhibin/activin betaB 

Sus scrofa domestica (domestic pig) ..... 1793 1 hit [mammals] inhibin betaB precursor 

Sus scrofa (pig) ............ 1793 5 hits [mammals] inhibin beta-(b) subunit precursor [Sus scrofa] 

Mus musculus (house mouse) ........... 1356 24 hits [mammals] INHIBIN BETA B CHAIN PRECURSOR 

Equus caballus (horse) .................. 846 2 hits [mammals] inhibin beta A subunit [Equus caballus]  

Dama sp. .................... 273 1 hit [mammals] Bone morphogenetic protein 2 [Dama sp.] 

Oryctolagus cuniculus (European rabbit) . 271 3 hits [mammals] bone morphogenetic protein 2 [Oryctolagus cuniculus] 

Texas fallow deer .........237 1 hit [mammals] bone morphogenetic protein 4B, BMP-4B [Texas Fallow deers, a 

Canis familiaris (dog) .................. 235 1 hit [mammals] bone morphogenetic protein 4 [Canis familiaris] 

Mus sp. (mice) ........ 233 1 hit [mammals] transforming growth factor-beta homolog=Vgr-2 [mice, embryo, 

Rangifer tarandus tarandus ...... 210 1 hit [mammals] bone morphogenetic protein 3b [Rangifer tarandus tarandus]

Gallus gallus (chicken) ------------------- 1749 15 hits [birds] activin beta B [Gallus gallus] 

Meleagris gallopavo (turkey) .............. 320 2 hits [birds] GROWTH/DIFFERENTIATION FACTOR 8 PRECURSOR (GDF-8) (MYOSTATIN 

Xenopus laevis (African clawed frog) - 1441 22 hits [amphibians] activin beta B subunit [Xenopus laevis, Peptide, 370 aa] 

Cynops pyrrhogaster (Japanese common newt) .. 897 2 hits [amphibians] activin beta-A subunit [Cynops pyrrhogaster] 

Eleutherodactylus cystignathoides ...... 232 1 hit [amphibians] Vg1 [Eleutherodactylus cystignathoides]

Activin/ Inhibin Beta B Protein Alignment (mammal, bird, amphibian):  ClustalW Results 2

Clustal Alignment of Human Inhibin beta A and beta B protein

Blast2 Alignment of Human Inhibin beta A and beta B protein

Back to Top

TGTGCTGCCGGCAACAGTTCTACATCGACTTCCGGCTCATCGGCTGGAACGACTGGATCA

TCGCGCCGTCGGGCTACTTCGGGAACTACTGCGAGGGCAACTGCCCGGCCTACATGGCGG

GCGTCCCCGGCTCGGCCTCGTCCTTCCACACGGCGGTGGTGAACCAGTACCGCATGCGGG

GCATGAGCCCCGGCTCCATGAACTCCTGCTGCATCCCCACCAAGCTCAGCACCATGTCCA

TGCTCTACTTCGACGACGAGTACAACATCGTCAAACGTGACGTGCCCAACATGATCGTGG

ACGAGTGCGGCTGCGCTTGACTGTCCGCTCCAGGACTCTGCAGATGGACGCTTCCACGGC

GGATATAAAACAGAATATTTATGAACTCGTCCCACACAGATCCACACACTCGCATGTATG

CCTGCAAAAAAAAAAAA

C  Silent mutation

G   in all clones except one that is a A and chamge the aa from a D to an N, most fish has D

Blastx search , Query= Fundulus Act/Inh Beta B 3'end (Composite)Nov 1 02 (437 bp)

BlastP search blink2, Query: gi|5821398 activin B [Anguilla japonica]

     http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/blink?pid=5821398&quq=4504699

Blast Taxonomy Report 3:  (Bony Fishes)  Activin/Inhibin Beta B

Anguilla japonica (Japanese eel) --------- 395 1 hit [bony fishes] activin B [Anguilla japonica]

Carassius auratus (goldfish) --1609 8 hits [bony fishes] activin beta B subunit precursor [Carassius auratus]  

Cyprinus carpio (common carp) ........ 613 4 hits [bony fishes] inhibin/activin [Cyprinus carpio] (beta B)

Danio rerio (zebrafish) ---------------- 1597 15 hits [bony fishes] activin beta B [Danio rerio] 

Chrysophrys major (red sea bream) -------- 622 1 hit [bony fishes] activin beta B [Chrysophrys major]

Oncorhynchus mykiss (rainbow trout). 521 3 hits [bony fishes] mature peptide [Oncorhynchus mykiss] (beta B)

Oryzias latipes (Japanese medaka) ........ 425 2 hits [bony fishes] inhibin/activin [Oryzias latipes] (beta A)

Sparus aurata (gilthead sea bream) ....... 412 1 hit [bony fishes] activin-b [Sparus aurata]

Fundulus heteroclitus (Atlantic killifish) . 204 1 hit [bony fishes] activin/inhibin beta B subunit [Fundulus heteroclitus]

Bony fish Activin/Inhibin Beta B Proteins Alignment : ClustalW Results 3

Bony fish  (with Fundulus) Activin/Inhibin Beta B Proteins Alignment : ClustalW Results 3.1

Bony fish Activin /Inhibin Beta B Nucleotide Alignment : ClustalW Results 4

Bony fish (with Fundulus) Activin /Inhibin Beta B Nucleotide Alignment : ClustalW Results 4.1

Activin /Inhibin Beta B (Goldfish, Zebrafish, Japanese eel) Nucleotide Alignment : ClustalW Results 5

Back to Top

_____________________________________________________

BlastP search blink3, Query: gi|4867809 activin beta A protein [Danio rerio]

     http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/blink?pid=4867809&quq=516357

    Entrez Proteins: Blast  Zebrafish Beta A  GI List 3

BlastP search blink3-1, Query: gi|516357 activin beta B [Danio rerio]

     http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/blink?pid=516357&quq=5821398

     Entrez Proteins: Blast  Zebrafish Beta B  GI List 4

Blast Taxonomy Report 4:  (Bony Fishes)  Activin/Inhibin Beta A

Cyprininae [bony fishes] 

Danio rerio (zebrafish) -------------- 568 17 hits [bony fishes] activin beta A protein [Danio rerio]

Carassius auratus (goldfish) ------- 584 8 hits [bony fishes] activin beta A precursor [Carassius auratus]  

Cyprinus carpio (common carp) ...... 559 4 hits [bony fishes] inhibin/activin [Cyprinus carpio] (beta A)

Danio rerio (zebrafish) -------------- 389 16 hits [bony fishes] activin beta B [Danio rerio] 

Oryzias latipes (Japanese medaka) ------ 568 2 hits [bony fishes] inhibin/activin [Oryzias latipes]  (beta A)

Oncorhynchus mykiss (rainbow trout) .487 3 hits [bony fishes] mature peptide [Oncorhynchus mykiss] (beta A) 

Chrysophrys major (red sea bream) ...... 359 2 hits [bony fishes] activin beta B [Chrysophrys major] 

Sparus aurata (gilthead sea bream) ..... 252 1 hit [bony fishes] activin-b [Sparus aurata] 

Anguilla japonica (Japanese eel) --------- 395 1 hit [bony fishes] activin B [Anguilla japonica]

Bony fish Activin/Inhibin Beta A Proteins Alignment : ClustalW Results 6

Bony fish Activin /Inhibin Beta A Nucleotide Aligment : ClustalW Results 7

Bony Fish Activin/Inhibin Beta A and Beta B Protein Alignment : ClustalW Results 8

Bony Fish Activin/Inhibin Beta A and Beta B Nucleotide Alignment : ClustalW Results 9

Back to Top

______________________________________________________

Inhibin/Activin Beta A and Beta B Protein Alignment

(Mammal, Bird, Amphibian, Fish) : ClustalW Results 10

Inhibin/Activin Beta A and Beta B Protein Alignment Complete

(Mammal, Bird, Amphibian, Fish) : ClustalW Results 11

Back to Top

Activin/Inhibin (Beta subunit) References

   Structure of two human ovarian inhibins. Mason AJ, Niall HD, Seeburg PH; PMID: 3754442, UI: 86186863

    Genomic cloning and sequence analyses of the bovine alpha-, beta A- and beta B-inhibin/activin genes. Identification of transcription factor AP-2-binding sites in the 5'-flanking regions by DNase I footprinting. Thompson DA, Cronin CN, Martin F; PMID: 7813465, UI: 95112839

    Tissue-specific variation in the length of the 5' untranslated region of the beta A-inhibin mRNA in sheep. Fleming JS, Galloway SM, Crawford RJ, Tisdall DJ, Greenwood PJ; PMID: 7702862, UI: 95217464

    Activins are expressed in preimplantation mouse embryos and in ES and EC cells and are regulated on their differentiation. Albano RM, Groome N, Smith JC; PMID: 8330535, UI: 93321614

    Rat inhibin: molecular cloning of alpha- and beta-subunit complementary deoxyribonucleic acids and expression in the ovary. Woodruff TK, Meunier H, Jones PB, Hsueh AJ, Mayo KE; PMID: 3153478, UI: 91042598

    Molecular cloning of cDNA for equine ovarian inhibin/activin beta A subunit. Yoshida S, Yamanouchi K, Hasegawa T, Ikeda A, Suzuki M, Chang KT, Matsuyama S, Nishihara M, Takahashi M; PMID: 7548399, UI: 96031670

    Expression of activin beta subunit genes in Sertoli cells of newt testes. Yamamoto T, Nakayama Y, Abe S; PMID: 8702409, UI: 96295508   

    Demonstration of activin-A in arteriosclerotic lesions. (European rabbit) Inoue S, Orimo A, Hosoi T, Ikegami A, Kozaki K, Ouchi Y, Nomura S, Muramatsu M, Orimo H; PMID: 7999062, UI: 95091764

    Cloning of cDNA for goldfish activin beta B subunit, and the expression of its mRNA in gonadal and non-gonadal tissues. Ge W, Miura T, Kobayashi H, Peter RE, Nagahama Y; PMID: 9278859, UI: 97424746